Biology
1

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

2

How many molecules of ATP and NADPH are required for every molecule of $$\mathrm{CO}_2$$ fixed in the Calvin cycle?

3

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

4

In the given figure, which component has thin outer walls and highly thickened inner walls?

NEET 2024 Biology - Anatomy of Flowering Plants Question 5 English

5

The cofactor of the enzyme carboxypeptidase is:

6

The capacity to generate a whole plant from any cell of the plant is called:

7

Match List I with List II

List - I List - II
A. Rhizopus I. Mushroom
B. Ustilago II. Smut fungus
C. Puccinia III. Bread mould
D. Agaricis IV. Rust fungus

Choose the correct answer from the options given below:

8

Given below are two statements:

Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.

Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic $$\mathrm{pH}$$ of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:

9

Which of the following is an example of actinomorphic flower?

10

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called

11

Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon like.

E. In some hydrophytes, the pollen grains are carried passively inside water.

Choose the correct answer from the options given below.

12

The lactose present in the growth medium of bacteria is transported to the cell by the action of

13

Match List I with List II

List - I List - II
A. Clostridium butylicum I. Ethanol
B. Saccharomyces cerevisiae II. Streptokinase
C. Trichoderma polysporum III. Butyric acid
D. Streptococcus sp. IV. Cyclosporin-A

Choose the correct answer from the options given below:

14

The equation of Verhulst-Pearl logistic growth is $$\frac{\mathrm{dN}}{\mathrm{dt}}=\mathrm{rN}\left[\frac{\mathrm{K}-\mathrm{N}}{\mathrm{K}}\right]$$. From this equation, $$\mathrm{K}$$ indicates:

15

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

16

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

NEET 2024 Biology - Morphology of Flowering Plants Question 7 English

17

Given below are two statements:

Statement I : Parenchyma is living but collenchyma is dead tissue.

Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.

In the light of the above statements, choose the correct answer from the options given below:

18

These are regarded as major causes of biodiversity loss:

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct option:

19

Which one of the following is not a criterion for classification of fungi?

20

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

NEET 2024 Biology - Morphology of Flowering Plants Question 6 English

21

List of endangered species was released by

22

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?

A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.

B. It may get integrated into the genome of the recipient.

C. It may multiply and be inherited along with the host DNA.

D. The alien piece of DNA is not an integral part of chromosome.

E. It shows ability to replicate.

Choose the correct answer from the options given below:

23

Which one of the following can be explained on the basis of Mendel's Law of Dominance?

A. Out of one pair of factors one is dominant and the other is recessive.

B. Alleles do not show any expression and both the characters appear as such in F$$_2$$ generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.

Choose the correct answer from the options given below:

24

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

25

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

26

Spindle fibers attach to kinetochores of chromosomes during

27

Tropical regions show greatest level of species richness because

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.

Choose the correct answer from the options given below.

28

Given below are two statements:

Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.

Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

29

Match List I with List II

List - I List - II
A. Nucleolus I. Site of formation of glycolipid
B. Centriole II. Organization like the cartwheel
C. Leucoplasts III. Site of active ribosomal RNA synthesis
D. Golgi apparatus IV. For storing nutrients

Choose the correct answer from the options given below:

30

Bulliform cells are responsible for

31

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

32

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

33

In a plant, black seed color $$(\mathrm{BB} / \mathrm{Bb})$$ is dominant over white seed color $$(\mathrm{bb})$$. In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

34

Which of the following are required for the dark reaction of photosynthesis?

A. Light

B. Chlorophyll

C. $$\mathrm{CO}_2$$

D. ATP

E. NADPH

Choose the correct answer from the options given below:

35

Match List I with List II

List - I List - II
A. Two or more alternative forms of a gene I. Back cross
B. Cross of F$$_1$$ progeny with homozygous recessive parent II. Ploidy
C. Cross of F$$_1$$ progeny with any of the parents III. Allele
D. Number of chromosome sets in plant IV. Test cross

Choose the correct answer from the options given below:

36

The DNA present in chloroplast is:

37

Match List I with List II

List - I List - II
A. Robert May I. Species-Area relationship
B. Alexander von Humboldt II. Long term ecosystem experiment using out door plots
C. Paul Ehrlich III. Global species diversity at about 7 million
D. David Tilman IV. Rivet popper hypothesis

Choose the correct answer from the options given below:

38

Match List I with List II

List - I List - II
A. Rose I. Twisted aestivation
B. Pea II. Perigynous flower
C. Cotton III. Drupe
D. Mango IV. Marginal placentation

Choose the correct answer from the options given below :

39

Which of the following statement is correct regarding the process of replication in E.coli?

40

Identify the correct description about the given figure :

NEET 2024 Biology - Sexual Reproduction in Flowering Plants Question 10 English

41

Match List I with List II

List - I List - II
A. Citric acid cycle I. Cytoplasm
B. Glycolysis II. Mitochondrial matrix
C. Electron transport system III. Intermembrane space of mitochondria
D. Proton gradient IV. Inner mitochondrial membrane

Choose the correct answer from the options given below:

42

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.

B. Sexual reproduction is by oogamous method only.

C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.

D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.

E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.

Choose the correct answer from the options given below:

43

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is $$100 x\left(\mathrm{kcal} \mathrm{~m}^{-2}\right) \mathrm{yr}^{-1}$$, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

44

Match List I with List II

List - I List - II
A. GLUT-4 I. Hormone
B. Insulin II. Enzyme
C. Trypsin III. Intercellular ground substance
D. Collagen IV. Enables glucose transport into cells

Choose the correct answer from the options given below.

45

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

46

Given below are two statements:

Statement I: In $$\mathrm{C}_3$$ plants, some $$\mathrm{O}_2$$ binds to $$\mathrm{RuBisCO}$$, hence $$\mathrm{CO}_2$$ fixation is decreased.

Statement II: In $$\mathrm{C}_4$$ plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, choose the correct answer from the options given below:

47

Match List I with List II

List - I
(Types of Stamens)
List - II
(Example)
A. Monoadelphous I. Citrus
B. Diadelphous II. Pea
C. Polyadelphous III. Lily
D. Epiphyllous IV. China-rose

Choose the correct answer from the options given below:

48

Match List I with List II

List - I List - II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Tranformation
D. Meselson & Stahl IV. Lac operon

Choose the correct answer from the options given below:

49

Which of the following are fused in somatic hybridization involving two varieties of plants?

50

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

51

Following are the stages of pathway for conduction of an action potential through the heart

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of pathway from the options given below

52

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

53

The flippers of the Penguins and Dolphins are the example of the

54

Which of the following is not a component of Fallopian tube?

55

Given below are some stages of human evolution.

Arrange them in correct sequence. (Past to Recent)

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

56

Which of the following is not a steroid hormone?

57

Match List I with List II

List - I List - II
A. $$\alpha$$ -I antitrypsin I. Cotton bollworm
B. Cry IAb II. ADA deficiency
C. Cry IAc III. Emphysema
D. Enzyme replacement therapy IV. Corn borer

Choose the correct answer form the options given below:

58

Following are the stages of cell division :

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below :

59

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

60

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

61

Match List I with List II:

List - I List - II
A. Typhoid I. Fungus
B. Leishmaniasis II. Nematode
C. Ringworm III. Protozoa
D. Filariasis IV. Bacteria

Choose the correct answer from the options given below:

62

Match List I with List II:

List - I List - II
A. Expiratory capacity I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
B. Functional residual capacity II. Tidal volume + Expiratory reserve volume
C. Vital capacity III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity IV. Expiratory reserve volume + Residual volume

Choose the correct answer from the options given below :

63

Match List I with List II :

List - I List - II
A. Down's syndrome I. 11$$^\mathrm{th}$$ chromosome
B. $$\alpha$$-thalassemia II. 'X' chromosome
C. $$\beta$$-thalassemia III. 21$$^\mathrm{st}$$ chromosome
D. Klinefelter's syndrome IV. 16$$^\mathrm{th}$$ chromosome

Choose the correct answer from the options given below :

64

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :

Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

In the light of the above statements, choose the correct answer from the options given below :

65

Match List I with List II:

List - I List - II
A. Pleurobrachia I. Mollusca
B. Radula II. Ctenophora
C. Stomochord III. Osteichthyes
D. Air bladder IV. Hemichordata

Choose the correct answer from the options given below :

66

Match List I with List II :

List - I
(Sub Phases of Prophase I)
List - II
(Specific Characters)
A. Diakinesis I. Synaptonemal complex formation
B. Pachytene II. Completion of terminalisation of chiasmata
C. Zygotene III. Chromosomes look like thin threads
D. Leptotene IV. Appearance of recombination nodules

Choose the correct answer from the options given below

67

The "Ti plasmid" of Agrobacterium tumefaciens stands for

68

Match List I with List II:

List - I List - II
A. Cocaine I. Effective sedative in surgery
B. Heroin II. Cannabis sativa
C. Morphine III. Erythroxylum
D. Marijuana IV. Papaver somniferum

Choose the correct answer from the options given below:

69

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3'TACATGGCAAATATCCATTCA5'

70

Match List I with List II:

List - I List - II
A. Pons I. Provides additional space for Neurons, regulates posture and balance.
B. Hypothalamus II. Controls respiration and gastric secretions.
C. Medulla III. Connects different regions of the brain.
D. Cerebellum IV. Neuro secretory cells

Choose the correct answer from the options given below :

71

Match List I with List II:

List - I List - II
A. Lipase I. Peptide bond
B. Nuclease II. Ester bond
C. Protease III. Glycosidic bond
D. Amylase IV. Phosphodiester bond

Choose the correct answer from the options given below :

72

Which of the following is not a natural/traditional contraceptive method?

73

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

NEET 2024 Biology - Locomotion and Movement Question 3 English

Name of muscle/location

74

Which of the following statements is incorrect?

75

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

76

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

77

Match List I with List II :

List - I List - II
A. Common cold I. Plasmodium
B. Haemozoin II. Typhoid
C. Widal test III. Rhinoviruses
D. Allergy IV. Dust mites

Choose the correct answer from the options given below :

78

Consider the following statements :

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates

Choose the correct answer from the options given below :

79

Match List I with List II

List - I List - II
A. Non-medicated IUD I. Multiload 375
B. Copper releasing IUD II. Progestogens
C. Hormone releasing IUD III. Lippes loop
D. Implants IV. LNG-20

Choose the correct answer from the option given below:

80

Given below are two statements :

Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the option given below :

81

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes :

NEET 2024 Biology - Biotechnology and It's Applications Question 3 English

82

Match List I with List II :

List - I List - II
A. Axoneme I. Centriole
B. Cartwheel pattern II. Cilia and flagella
C. Crista III. Chromosome
D. Satellite IV. Mitochondria

Choose the correct answer from the options given below :

83

Match List I with List II :

List - I List - II
A. Pterophyllum I. Hag fish
B. Myxine II. Saw fish
C. Pristis III. Angel fish
D. Exocoetus IV. Flying fish

Choose the correct answer from the options given below :

84

Match List I with List II :

List - I List - II
A. Fibrous joints I. Adjacent vertebrae, limited movement
B. Cartilaginous joints II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints III. Skull, don't allow any movement
D. Ball and socket joints IV. Knee, help in locomotion

Choose the correct answer from the options given below :

85

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above above statements, choose the correct answer from the options given below :

86

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below :

87

Match List I with List II related to digestive system of cockroach.

List - I List - II
A. The structures used for storing of food I. Gizzaard
B. Ring of 6-8 blind tubules at junction of foregut and midgut. II. Gastric Caeca
C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut. III. Malpighian tubules
D. The structures used for grinding the food. IV. Crop

Choose the correct answer from the options given below:

88

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

Choose the most appropriate answer from the options given below:

89

Choose the correct statement given below regarding juxta medullary nephron.

90

Given below are two statements:

Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

91

Given below are two statements :

Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II : Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes.

In the light of above statements, choose the most appropriate answer from the options given below

92

Regarding catalytic cycle of an enzyme action, select the correct sequential steps :

A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.

Choose the correct answer from the options given below :

93

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

NEET 2024 Biology - Human Reproduction Question 10 English

94

Match List I with List II:

List - I List - II
A. Mesozoic Era I. Lower invertebrates
B. Proterozoic Era II. Fish & Amphibia
C. Cenozoic Era III. Birds & Reptiles
D. Paleozoic Era IV. Mammals

Choose the correct answer from the options given below :

95

Match List I with List II:

List - I List - II
A. Unicellular glandular epithelium I. Salivary glands
B. Compound epithelium II. Pancreas
C. Multicellular glandular epithelium III. Goblet cells of alimentary canal
D. Endocrine glandular epithelium IV. Moist surface of buccal cavity

Choose the correct answer from the options given below:

96

Match List I with List II:

List - I List - II
A. RNA polymerase III I. snRNPs
B. Termination of transcription II. Promotor
C. Splicing of Exons III. Rho factor
D. TATA box IV. SnRNAs, tRNA

Choose the correct answer from the options given below :

97

As per ABO blood grouping system, the blood group of father is $$\mathrm{B}^{+}$$, mother is $$\mathrm{A}^{+}$$ and child is $$\mathrm{O}^{+}$$. Their respective genotype can be

A. IBi/IAi/ii

B. IBIB/IAIA/ii

C. iIB/iIA/IAIB

D. IAi/IBi/IAi

E. iIB/iIA/IAIB

Choose the most appropriate answer from the options given below :

98

Match List I with List II :

List - I List - II
A. P wave (i) Heart muscles are electrically silent.
B. QRS complex (ii) Depolarisation of ventricles.
C. T wave (iii) Depolarisation of atria.
D. T-P gap (iv) Repolarisation of ventricles.

Choose the correct answer from the options given below :

99

Given below are two statements:

Statement I: Mitochondria and chloroplasts both double membranes bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast.

In the light of the above statements, choose the mis appropriate answer from the options given below:

100

Match List I with List II :

List - I List - II
A. Exophthalmic goiter I. Excess secretion of cortisol, moon face \& hypergylcemia.
B. Acromegaly II. Hypo-secretion of thyroid hormone and stunted growth.
C. Cushing's syndrome III. Hyper secretion of thyroid hormone \& protruding eye balls.
D. Cretinism IV. Excessive secretion of growth hormone.

Choose the correct answer from the options given below :

Chemistry
1

Match List I with List II.

List I
(Molecule)
List II
(Number and types of bond/s between two carbon atoms)
A. ethane I. one $$\sigma$$-bond and two $$\pi$$-bonds
B. ethene II. two $$\pi$$-bonds
C. carbon molecule, C$$_2$$ III. one $$\sigma$$-bond
D. ethyne IV. one $$\sigma$$-bond and one $$\pi$$-bond

Choose the correct answer from the options given below :

2

The Henry's law constant $$(\mathrm{K}_{\mathrm{H}})$$ values of three gases $$(\mathrm{A}, \mathrm{B}, \mathrm{C})$$ in water are $$145, 2 \times 10^{-5}$$ and $$35 \mathrm{~kbar}$$ respectively. The solubility of these gases in water follow the order:

3

Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follow the order $$\mathrm{H}_2 \mathrm{O}>\mathrm{H}_2 \mathrm{Te}>\mathrm{H}_2 \mathrm{Se}>\mathrm{H}_2 \mathrm{S} \text {. }$$

Statement II: On the basis of molecular mass, $$\mathrm{H}_2 \mathrm{O}$$ is expected to have lower boiling point than the other members of the group but due to the presence of extensive $$\mathrm{H}$$-bonding in $$\mathrm{H}_2 \mathrm{O}$$, it has higher boiling point.

In the light of the above statements, choose the correct answer from the options given below:

4

Intramolecular hydrogen bonding is present in

5

Given below are two statements:

Statement I : The boiling point of three isomeric pentanes follows the order

n-pentane > isopentane > neopentane

Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

In the light of the above statements, choose the most appropriate answer from the options given below:

6

The compound that will undergo SN1 reaction with the fastest rate is

7

Which one of the following alcohols reacts instantaneously with Lucas reagent?

8

1 gram of sodium hydroxide was treated with $$25 \mathrm{~mL}$$ of $$0.75 \mathrm{~M} \mathrm{~HCl}$$ solution, the mass of sodium hydroxide left unreacted is equal to

9

Arrange the following elements in increasing order of first ionization enthalpy: $$\mathrm{Li}, \mathrm{Be}, \mathrm{B}, \mathrm{C}, \mathrm{N}$$

Choose the correct answer from the options given below:

10

The most stable carbocation among the following is :

11

Activation energy of any chemical reaction can be calculated if one knows the value of

12

Given below are two statements:

Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction.

Statement II : Aniline cannot be prepared through Gabriel synthesis.

In the light of the above statements, choose the correct answer from the options given below:

13

Arrange the following elements in increasing order of electronegativity:

N, O, F, C, Si

Choose the correct answer from the options given below :

14

Match List I with List II.

List I
(Conversion)
List II
(Number of Faraday required)
A. 1 mole of H$$_2$$O to O$$_2$$ I. 3F
B. 1 mol of MnO$$_4^-$$ to Mn$$^{2+}$$ II. 2F
C. 1.5 mol of Ca from molten CaCl$$_2$$ III. 1F
D. 1 mol of FeO to Fe$$_2$$O$$_3$$ IV. 5F

Choose the correct answer from the options given below :

15

Match List I with List II.

List I
(Complex)
List II
(Type of isomerism)
A. $$
\left[\mathrm{Co}\left(\mathrm{NH}_3\right)_5\left(\mathrm{NO}_2\right)\right] \mathrm{Cl}_2
$$
I. Solvate isomerism
B. $$
\left[\mathrm{Co}\left(\mathrm{NH}_3\right)_5\left(\mathrm{SO}_4\right)\right] \mathrm{Br}
$$
II. Linkage isomerism
C. $$
\left[\mathrm{Co}\left(\mathrm{NH}_3\right)_6\right]\left[\mathrm{Cr}(\mathrm{CN})_6\right]
$$
III. Ionization isomerism
D. $$
\left[\mathrm{Co}\left(\mathrm{H}_2 \mathrm{O}\right)_6\right] \mathrm{Cl}_3
$$
IV. Coordination isomerism

Choose the correct answer from the options given below:

16

Match List I with List II.

List I
(Compound)
List II
(Shape/geometry)
A. NH$$_3$$ I. Trigonal Pyramidal
B. BrF$$_5$$ II. Square Planar
C. XeF$$_4$$ III. Octahedral
D. SF$$_6$$ IV. Square Pyramidal

Choose the correct answer from the options given below:

17

Which plot of $$\ln \mathrm{k}$$ vs $$\frac{1}{\mathrm{~T}}$$ is consistent with Arrhenius equation?

18

The energy of an electron in the ground state $$\mathrm{(n=1)}$$ for $$\mathrm{He}^{+}$$ ion is $$\mathrm{-x} \mathrm{~J}$$, then that for an electron in $$\mathrm{(n=2)}$$ state for $$\mathrm{Be}^{3+}$$ ion in $$\mathrm{J}$$ is

19

In which of the following processes entropy increases?

A. A liquid evaporates to vapour.

B. Temperature of a crystalline solid lowered from $$130 \mathrm{~K}$$ to $$0 \mathrm{~K}$$.

C. $$2 \mathrm{NaHCO}_{3(\mathrm{~s})} \rightarrow \mathrm{Na}_2 \mathrm{CO}_{3(\mathrm{~s})}+\mathrm{CO}_{2(\mathrm{~g})}+\mathrm{H}_2 \mathrm{O}_{(\mathrm{g})}$$

D. $$\mathrm{Cl}_{2(g)} \rightarrow 2 \mathrm{Cl}_{(g)}$$

Choose the correct answer from the options given below:

20

Which reaction is NOT a redox reaction?

21

Match List I with List II.

List I
(Quantum Number)
List II
(Information provided)
A. $$\mathrm{m_l}$$ I. Shape of orbital
B. $$\mathrm{m_s}$$ II. Size of orbital
C. I III. Orientation of orbital
D. n IV. Orientation of spin of electron

Choose the correct answer from the options given below :

22

'Spin only' magnetic moment is same for which of the following ions?

A. $$\mathrm{Ti}^{3+}$$

B. $$\mathrm{Cr}^{2+}$$

C. $$\mathrm{Mn}^{2+}$$

D. $$\mathrm{Fe}^{2+}$$

E. $$\mathrm{Sc}^{3+}$$

Choose the most appropriate answer from the options given below.

23

The highest number of helium atoms is in

24

Among Group 16 elements, which one does NOT show -2 oxidation state?

25

The $$\mathrm{E}^{\circ}$$ value for the $$\mathrm{Mn}^{3+} / \mathrm{Mn}^{2+}$$ couple is more positive than that of $$\mathrm{Cr}^{3+} / \mathrm{Cr}^{2+}$$ or $$\mathrm{Fe}^{3+} / \mathrm{Fe}^{2+}$$ due to change of

26

The reagents with which glucose does not react to give the corresponding tests/products are

A. Tollen's reagent

B. Schiff's reagent

C. HCN

D. $$\mathrm{NH}_2 \mathrm{OH}$$

E. $$\mathrm{NaHSO}_3$$

Choose the correct options from the given below:

27

Identify the correct reagents that would bring about the following transformation.

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 4 English

28

In which of the following equilibria, $$\mathrm{K}_p$$ and $$\mathrm{K}_{\mathrm{c}}$$ are NOT equal?

29

A compound with a molecular formula of $$\mathrm{C}_6 \mathrm{H}_{14}$$ has two tertiary carbons. Its IUPAC name is :

30

Fehling's solution 'A' is

31

Match List I with List II.

List I
(Process)
List II
(Conditions)
A. Isothermal process I. No heat exchange
B. Isochoric process II. Carried out at constant temperature
C. Isobaric process III. Carried out at constant volume
D. Adiabatic process IV. Carried out at constant pressure

Choose the correct answer from the options given below:

32

Given below are two statements :

Statement I: Both $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ and $$[\mathrm{CoF}_6]^{3-}$$ complexes are octahedral but differ in their magnetic behaviour.

Statement II: $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ is diamagnetic whereas $$[\mathrm{CoF}_6]^{3-}$$ is paramagnetic.

In the light of the above statements, choose the correct answer from the options given below:

33

On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

34

Match List I with List II.

List I
(Reaction)
List II
(Reagents/Condition)
A. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 6 English 1 I. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 6 English 2
B. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 6 English 3 II. CrO$$_3$$
C. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 6 English 4 III. KMnO$$_4$$/KOH, $$\Delta$$
D. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 6 English 5 IV. (i) O$$_3$$
(ii) Zn-H$$_2$$O

Choose the correct answer from the options given below:

35

For the reaction $$2 \mathrm{~A} \rightleftharpoons \mathrm{B}+\mathrm{C}, \mathrm{K}_{\mathrm{c}}=4 \times 10^{-3}$$. At a given time, the composition of reaction mixture is: $$[A]=[B]=[C]=2 \times 10^{-3} \mathrm{M} \text {. }$$ Then, which of the following is correct?

36

The pair of lanthanoid ions which are diamagnetic is

37

Given below are two statements :

Statement I : $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ is a homoleptic complex whereas $$[\mathrm{Co}(\mathrm{NH}_3)_4 \mathrm{Cl}_2]^{+}$$ is a heteroleptic complex.

Statement II : Complex $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ has only one kind of ligands but $$[\mathrm{Co}(\mathrm{NH}_3)_4 \mathrm{Cl}_2]^{+}$$ has more than one kind of ligands.

In the light of the above statements, choose the correct answer from the options given below.

38

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given : Molar mass of $$\mathrm{Cu}: 63 \mathrm{~g} \mathrm{~mol}^{-1}, 1 \mathrm{~F}=96487 \mathrm{C}$$)

39

For the given reaction:

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 5 English

'P' is

40

The products $$\mathrm{A}$$ and $$\mathrm{B}$$ obtained in the following reactions, respectively, are

$$\begin{aligned} & 3 \mathrm{ROH}+\mathrm{PCl}_3 \rightarrow 3 \mathrm{RCl}+\mathrm{A} \\ & \mathrm{ROH}+\mathrm{PCl}_5 \rightarrow \mathrm{RCl}+\mathrm{HCl}+\mathrm{B} \end{aligned}$$

41

The rate of a reaction quadruples when temperature changes from $$27^{\circ} \mathrm{C}$$ to $$57^{\circ} \mathrm{C}$$. Calculate the energy of activation.

Given $$\mathrm{R}=8.314 \mathrm{~J} \mathrm{~K}^{-1} \mathrm{~mol}^{-1}, \log 4=0.6021$$

42

During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of $$\mathrm{Fe}^{2+}$$ ion?

43

Major products A and B formed in the following reaction sequence, are

NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 4 English

44

The plot of osmotic pressure (П) vs concentration $$(\mathrm{mol} \mathrm{~L}^{-1})$$ for a solution gives a straight line with slope $$25.73 \mathrm{~L} \mathrm{~bar} \mathrm{~mol}^{-1}$$. The temperature at which the osmotic pressure measurement is done is

(Use $$\mathrm{R}=0.083 \mathrm{~L} \mathrm{~bar} \mathrm{~mol}^{-1} \mathrm{~K}^{-1}$$)

45

Identify the correct answer.

46

Identify the major product C formed in the following reaction sequence :

$$ \mathrm{CH}_3-\mathrm{CH}_2-\mathrm{CH}_2-\mathrm{I} \xrightarrow{\mathrm{NaCN}} \mathrm{A} $$

$$\mathrm{\mathrel{\mathop{\kern0pt\longrightarrow} \limits_{Partial\,hydrolysis}^{O{H^ - }}} B\mathrel{\mathop{\kern0pt\longrightarrow} \limits_{B{r_2}}^{NaOH}} \mathop C\limits_{(major)}}$$

47

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to $$\mathrm{VI}$$.

A. $$\mathrm{Al}^{3+}$$

B. $$\mathrm{Cu}^{2+}$$

C. $$\mathrm{Ba}^{2+}$$

D. $$\mathrm{Co}^{2+}$$

E. $$\mathrm{Mg}^{2+}$$

Choose the correct answer from the options given below.

48

The work done during reversible isothermal expansion of one mole of hydrogen gas at $$25^{\circ} \mathrm{C}$$ from pressure of 20 atmosphere to 10 atmosphere is (Given $$\mathrm{R}=2.0 \mathrm{~cal} \mathrm{~K}^{-1} \mathrm{~mol}^{-1}$$)

49

Consider the following reaction in a sealed vessel at equilibrium with concentrations of $$\mathrm{N}_2=3.0 \times 10^{-3} \mathrm{M}, \mathrm{O}_2=4.2 \times 10^{-3} \mathrm{M}$$ and $$\mathrm{NO}=2.8 \times 10^{-3} \mathrm{M}$$.

$$2 \mathrm{NO}_{(\mathrm{g})} \rightleftharpoons \mathrm{N}_{2(\mathrm{~g})}+\mathrm{O}_{2(\mathrm{~g})}$$

If $$0.1 \mathrm{~mol} \mathrm{~L} \mathrm{~L}^{-1}$$ of $$\mathrm{NO}_{(\mathrm{g})}$$ is taken in a closed vessel, what will be degree of dissociation ($$\alpha$$) of $$\mathrm{NO}_{(\mathrm{g})}$$ at equilibrium?

50

A compound X contains $$32 \%$$ of A, $$20 \%$$ of B and remaining percentage of C. Then, the empirical formula of $$\mathrm{X}$$ is :

(Given atomic masses of A=64 ; B=40 ; C=32 u)

Physics
1

In a vernier callipers, $$(N+1)$$ divisions of vernier scale coincide with $$N$$ divisions of main scale. If $$1 \mathrm{~MSD}$$ represents $$0.1 \mathrm{~mm}$$, the vernier constant (in $$\mathrm{cm}$$) is:

2

If the monochromatic source in Young's double slit experiment is replaced by white light, then

3

A logic circuit provides the output $$Y$$ as per the following truth table :

NEET 2024 Physics - Semiconductor Electronics Question 7 English

The expression of the output Y is :

4

The terminal voltage of the battery, whose emf is $$10 \mathrm{~V}$$ and internal resistance $$1 \Omega$$, when connected through an external resistance of $$4 \Omega$$ as shown in the figure is:

NEET 2024 Physics - Current Electricity Question 8 English

5

In a uniform magnetic field of $$0.049 \mathrm{~T}$$, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is $$9.8 \times 10^{-6} \mathrm{~kg} \mathrm{~m}^2$$. If the magnitude of magnetic moment of the needle is $$x \times 10^{-5} \mathrm{~Am}^2$$, then the value of '$$x$$' is :

NEET 2024 Physics - Magnetism and Matter Question 7 English

6

A wire of length '$$l$$' and resistance $$100 \Omega$$ is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

7

A horizontal force $$10 \mathrm{~N}$$ is applied to a block $$A$$ as shown in figure. The mass of blocks $$A$$ and $$B$$ are $$2 \mathrm{~kg}$$ and 3 $$\mathrm{kg}$$ respectively. The blocks slide over a frictionless surface. The force exerted by block $$A$$ on block $$B$$ is :

NEET 2024 Physics - Laws of Motion Question 3 English

8

A tightly wound 100 turns coil of radius $$10 \mathrm{~cm}$$ carries a current of $$7 \mathrm{~A}$$. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as $$4 \pi \times 10^{-7} \mathrm{SI}$$ units):

9

In an ideal transformer, the turns ratio is $$\frac{N_P}{N_S}=\frac{1}{2}$$. The ratio $$V_S: V_P$$ is equal to (the symbols carry their usual meaning) :

10

The graph which shows the variation of $$\left(\frac{1}{\lambda^2}\right)$$ and its kinetic energy, $$E$$ is (where $$\lambda$$ is de Broglie wavelength of a free particle):

11

Given below are two statements:

Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

Statement II: Atoms of each element are stable and emit their characteristic spectrum.

In the light of the above statements, choose the most appropriate answer from the options given below.

12

A bob is whirled in a horizontal plane by means of a string with an initial speed of $$\omega \mathrm{~rpm}$$. The tension in the string is $$T$$. If speed becomes $$2 \omega$$ while keeping the same radius, the tension in the string becomes:

13

Consider the following statements A and B and identify the correct answer :

NEET 2024 Physics - Semiconductor Electronics Question 6 English

A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.

B. In a reverse biased $$p n$$ junction diode, the current measured in $$(\mu \mathrm{A})$$, is due to majority charge carriers.

14

A thermodynamic system is taken through the cycle $$abcda$$. The work done by the gas along the path $$b c$$ is:

NEET 2024 Physics - Heat and Thermodynamics Question 9 English

15

A thin spherical shell is charged by some source. The potential difference between the two points $$C$$ and $$P$$ (in V) shown in the figure is:

(Take $$\frac{1}{4 \pi \varepsilon_0}=9 \times 10^9$$ SI units)

NEET 2024 Physics - Electrostatics Question 5 English

16

The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is $$2400 \mathrm{~g} \mathrm{~cm}^2$$. The length of the $$400 \mathrm{~g}$$ rod is nearly:

17

A particle moving with uniform speed in a circular path maintains:

18

If $$c$$ is the velocity of light in free space, the correct statements about photon among the following are:

A. The energy of a photon is $$E=h v$$.

B. The velocity of a photon is $$c$$.

C. The momentum of a photon, $$p=\frac{h v}{c}$$.

D. In a photon-electron collision, both total energy and total momentum are conserved.

E. Photon possesses positive charge.

Choose the correct answer from the options given below:

19

At any instant of time $$t$$, the displacement of any particle is given by $$2 t-1$$ ($$\mathrm{SI}$$ unit) under the influence of force of $$5 \mathrm{~N}$$. The value of instantaneous power is (in $$\mathrm{SI}$$ unit):

20

A light ray enters through a right angled prism at point $$P$$ with the angle of incidence $$30^{\circ}$$ as shown in figure. It travels through the prism parallel to its base $$B C$$ and emerges along the face $$A C$$. The refractive index of the prism is:

NEET 2024 Physics - Geometrical Optics Question 4 English

21

In the following circuit, the equivalent capacitance between terminal A and terminal B is :

NEET 2024 Physics - Capacitor Question 5 English

22

The quantities which have the same dimensions as those of solid angle are:

23

The maximum elongation of a steel wire of $$1 \mathrm{~m}$$ length if the elastic limit of steel and its Young's modulus, respectively, are $$8 \times 10^8 \mathrm{~N} \mathrm{~m}^{-2}$$ and $$2 \times 10^{11} \mathrm{~N} \mathrm{~m}^{-2}$$, is:

24

NEET 2024 Physics - Magnetism and Matter Question 5 English

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

25

The mass of a planet is $$\frac{1}{10}$$th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

26

Match List I with List II:

List I
(Spectral Lines of Hydrogen for transitions from)
List II
(Wavelengths (nm))
A. $$
n_2=3 \text { to } n_1=2
$$
I. 410.2
B. $$
n_2=4 \text { to } n_1=2
$$
II. 434.1
C. $$
n_2=5 \text { to } n_1=2
$$
III. 656.3
D. $$
n_2=6 \text { to } n_1=2
$$
IV. 486.1

Choose the correct answer from the options given below:

27

An unpolarised light beam strikes a glass surface at Brewster's angle. Then

28

Match List I with List II

List I
(Material)
List II
(Susceptibility ($$\chi))
A. Diamagnetic I. $$\chi=0$$
B. Ferromagnetic II. $$0 > \chi \ge -1$$
C. Paramagnetic III. $$\chi >> 1$$
D. Non-magnetic IV. $$0 < \chi < \varepsilon$$ (a small positive number)

Choose the correct answer from the options given below.

29

Two bodies $$A$$ and $$B$$ of same mass undergo completely inelastic one dimensional collision. The body $$A$$ moves with velocity $$v_1$$ while body $$B$$ is at rest before collision. The velocity of the system after collision is $$v_2$$. The ratio $$v_1: v_2$$ is

30

$$ { }_{82}^{290} X \xrightarrow{\alpha} Y \xrightarrow{e^{+}} Z \xrightarrow{\beta^{-}} P \xrightarrow{e^{-}} Q $$

In the nuclear emission stated above, the mass number and atomic number of the product $$Q$$ respectively, are

31

If $$x=5 \sin \left(\pi t+\frac{\pi}{3}\right) \mathrm{m}$$ represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are

32

A thin flat circular disc of radius $$4.5 \mathrm{~cm}$$ is placed gently over the surface of water. If surface tension of water is $$0.07 \mathrm{~N} \mathrm{~m}^{-1}$$, then the excess force required to take it away from the surface is

33

$$ \text { The output ( } Y \text { ) of the given logic gate is similar to the output of an/a } $$

NEET 2024 Physics - Semiconductor Electronics Question 8 English

34

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: The potential (V) at any axial point, at $$2 \mathrm{~m}$$ distance $$(r)$$ from the centre of the dipole of dipole moment vector $$\vec{P}$$ of magnitude, $$4 \times 10^{-6} \mathrm{C} \mathrm{m}$$, is $$\pm 9 \times 10^3 \mathrm{~V}$$.

(Take $$\frac{1}{4 \pi \epsilon_0}=9 \times 10^9 \mathrm{SI}$$ units)

Reason R: $$V= \pm \frac{2 P}{4 \pi \epsilon_0 r^2}$$, where $$r$$ is the distance of any axial point, situated at $$2 \mathrm{~m}$$ from the centre of the dipole.

In the light of the above statements, choose the correct answer from the options given below:

35

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is $$v$$ in the direction shown, which one of the following options is correct ($$P$$ and $$Q$$ are any highest and lowest points on the wheel, respectively)?

NEET 2024 Physics - Rotational Motion Question 5 English

36

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If $$I$$ is the current in the circuit, then in the gap between the plates:

37

The property which is not of an electromagnetic wave travelling in free space is that:

38

A small telescope has an objective of focal length $$140 \mathrm{~cm}$$ and an eye piece of focal length $$5.0 \mathrm{~cm}$$. The magnifying power of telescope for viewing a distant object is:

39

Two heaters $$A$$ and $$B$$ have power rating of $$1 \mathrm{~kW}$$ and $$2 \mathrm{~kW}$$, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

40

The following graph represents the $$T$$-$$V$$ curves of an ideal gas (where $$T$$ is the temperature and $$V$$ the volume) at three pressures $$P_1, P_2$$ and $$P_3$$ compared with those of Charles's law represented as dotted lines.

NEET 2024 Physics - Heat and Thermodynamics Question 8 English

Then the correct relation is :

41

The velocity $$(v)-$$ time $$(t)$$ plot of the motion of a body is shown below:

NEET 2024 Physics - Motion in a Straight Line Question 4 English

The acceleration $$(a)-$$ time $$(t)$$ graph that best suits this motion is :

42

Choose the correct circuit which can achieve the bridge balance.

43

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is $$\frac{x}{2}$$ times its original time period. Then the value of $$x$$ is:

44

The minimum energy required to launch a satellite of mass $$m$$ from the surface of earth of mass $$M$$ and radius $$R$$ in a circular orbit at an altitude of $$2 R$$ from the surface of the earth is:

45

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:

A. hold the sheet there if it is magnetic.

B. hold the sheet there if it is non-magnetic.

C. move the sheet away from the pole with uniform velocity if it is conducting.

D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.

Choose the correct statement(s) from the options given below:

46

A $$10 \mu \mathrm{F}$$ capacitor is connected to a $$210 \mathrm{~V}, 50 \mathrm{~Hz}$$ source as shown in figure. The peak current in the circuit is nearly $$(\pi=3.14)$$ :

NEET 2024 Physics - Alternating Current Question 5 English

47

A metallic bar of Young's modulus, $$0.5 \times 10^{11} \mathrm{~N} \mathrm{~m}^{-2}$$ and coefficient of linear thermal expansion $$10^{-5}{ }^{\circ} \mathrm{C}^{-1}$$, length $$1 \mathrm{~m}$$ and area of cross-section $$10^{-3} \mathrm{~m}^2$$ is heated from $$0^{\circ} \mathrm{C}$$ to $$100^{\circ} \mathrm{C}$$ without expansion or bending. The compressive force developed in it is :

48

An iron bar of length $$L$$ has magnetic moment $$M$$. It is bent at the middle of its length such that the two arms make an angle $$60^{\circ}$$ with each other. The magnetic moment of this new magnet is :

49

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then

A. the charge stored in it, increases.

B. the energy stored in it, decreases.

C. its capacitance increases.

D. the ratio of charge to its potential remains the same.

E. the product of charge and voltage increases.

Choose the most appropriate answer from the options given below:

50

A force defined by $$F=\alpha t^2+\beta t$$ acts on a particle at a given time $$t$$. The factor which is dimensionless, if $$\alpha$$ and $$\beta$$ are constants, is:

1
NEET 2024
MCQ (Single Correct Answer)
+4
-1

Two heaters $$A$$ and $$B$$ have power rating of $$1 \mathrm{~kW}$$ and $$2 \mathrm{~kW}$$, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

A
$$1: 1$$
B
$$2: 9$$
C
$$1: 2$$
D
$$2: 3$$
2
NEET 2024
MCQ (Single Correct Answer)
+4
-1

The following graph represents the $$T$$-$$V$$ curves of an ideal gas (where $$T$$ is the temperature and $$V$$ the volume) at three pressures $$P_1, P_2$$ and $$P_3$$ compared with those of Charles's law represented as dotted lines.

NEET 2024 Physics - Heat and Thermodynamics Question 8 English

Then the correct relation is :

A
$$P_3>P_2>P_1$$
B
$$P_1>P_3>P_2$$
C
$$P_2>P_1>P_3$$
D
$$P_1>P_2>P_3$$
3
NEET 2024
MCQ (Single Correct Answer)
+4
-1

The velocity $$(v)-$$ time $$(t)$$ plot of the motion of a body is shown below:

NEET 2024 Physics - Motion in a Straight Line Question 4 English

The acceleration $$(a)-$$ time $$(t)$$ graph that best suits this motion is :

A
NEET 2024 Physics - Motion in a Straight Line Question 4 English Option 1
B
NEET 2024 Physics - Motion in a Straight Line Question 4 English Option 2
C
NEET 2024 Physics - Motion in a Straight Line Question 4 English Option 3
D
NEET 2024 Physics - Motion in a Straight Line Question 4 English Option 4
4
NEET 2024
MCQ (Single Correct Answer)
+4
-1

Choose the correct circuit which can achieve the bridge balance.

A
NEET 2024 Physics - Current Electricity Question 7 English Option 1
B
NEET 2024 Physics - Current Electricity Question 7 English Option 2
C
NEET 2024 Physics - Current Electricity Question 7 English Option 3
D
NEET 2024 Physics - Current Electricity Question 7 English Option 4