Botany
Cell - The Unit of Life
MCQ (Single Correct Answer)Biomolecules
MCQ (Single Correct Answer)Cell Cycle and Cell Division
MCQ (Single Correct Answer)Sexual Reproduction in Flowering Plants
MCQ (Single Correct Answer)Microbes in Human Welfare
MCQ (Single Correct Answer)Anatomy of Flowering Plants
MCQ (Single Correct Answer)Transport in Plants
MCQ (Single Correct Answer)Mineral Nutrition
MCQ (Single Correct Answer)Respiration in Plants
MCQ (Single Correct Answer)Biotechnology: Principles and Processes
MCQ (Single Correct Answer)Biodiversity and Conservation
MCQ (Single Correct Answer)The Living World
MCQ (Single Correct Answer)Biological Classification
MCQ (Single Correct Answer)Morphology of Flowering Plants
MCQ (Single Correct Answer)Photosynthesis in Higher Plants
MCQ (Single Correct Answer)Principles of Inheritance and Variation
MCQ (Single Correct Answer)Strategies for Enhancement in Food Production
MCQ (Single Correct Answer)Biotechnology and It's Applications
MCQ (Single Correct Answer)Organisms and Populations
MCQ (Single Correct Answer)Environmental Issues
MCQ (Single Correct Answer)Plant Kingdom
MCQ (Single Correct Answer)Ecosystem
MCQ (Single Correct Answer)Zoology
Human Health and Diseases
MCQ (Single Correct Answer)Body Fluids and Its Circulation
MCQ (Single Correct Answer)Neural Control and Coordination
MCQ (Single Correct Answer)Reproduction in Organisms
MCQ (Single Correct Answer)Structural Organisation in Animals
MCQ (Single Correct Answer)Excretory Products and Their Elimination
MCQ (Single Correct Answer)Chemical Coordination and Integration
MCQ (Single Correct Answer)Human Reproduction
MCQ (Single Correct Answer)Animal Kingdom
MCQ (Single Correct Answer)Breathing and Exchange of Gases
MCQ (Single Correct Answer)1
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Which of the following statement is correct regarding the process of replication in E.coli?
2
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Match List I with List II
List - I | List - II | ||
---|---|---|---|
A. | Frederick Griffith | I. | Genetic code |
B. | Francois Jacob & Jacque Monod | II. | Semi-conservative mode of DNA replication |
C. | Har Gobind Khorana | III. | Tranformation |
D. | Meselson & Stahl | IV. | Lac operon |
Choose the correct answer from the options given below:
3
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Match List I with List II :
List - I | List - II | ||
---|---|---|---|
A. | Down's syndrome | I. | 11$$^\mathrm{th}$$ chromosome |
B. | $$\alpha$$-thalassemia | II. | 'X' chromosome |
C. | $$\beta$$-thalassemia | III. | 21$$^\mathrm{st}$$ chromosome |
D. | Klinefelter's syndrome | IV. | 16$$^\mathrm{th}$$ chromosome |
Choose the correct answer from the options given below :
4
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Questions Asked from MCQ (Single Correct Answer)
NEET 2025 (7) NEET 2024 (Re-Examination) (4) NEET 2024 (7) NEET 2023 Manipur (9) NEET 2023 (7) NEET 2022 Phase 2 (6) NEET 2022 Phase 1 (8) NEET 2021 (10) NEET 2020 Phase 1 (4) NEET 2019 (6) NEET 2018 (7) NEET 2017 (6) NEET 2016 Phase 2 (5) NEET 2016 Phase 1 (3) AIPMT 2015 (4) AIPMT 2015 Cancelled Paper (2) AIPMT 2014 (2) NEET 2013 (Karnataka) (6) NEET 2013 (3) AIPMT 2012 Prelims (5) AIPMT 2011 Mains (1) AIPMT 2011 Prelims (1) AIPMT 2010 Mains (4) AIPMT 2010 Prelims (4) AIPMT 2009 (4) AIPMT 2008 (4) AIPMT 2006 (5) AIPMT 2005 (7) AIPMT 2004 (5) AIPMT 2003 (7) AIPMT 2002 (9) AIPMT 2001 (4) AIPMT 2000 (6)
NEET Subjects
Physics
Mechanics
Electricity
Chemistry
Physical Chemistry
Inorganic Chemistry
Biology
Botany
Cell - The Unit of LifeBiomoleculesCell Cycle and Cell DivisionSexual Reproduction in Flowering PlantsMicrobes in Human WelfareAnatomy of Flowering PlantsTransport in PlantsMineral NutritionRespiration in PlantsBiotechnology: Principles and ProcessesBiodiversity and ConservationThe Living WorldBiological ClassificationMorphology of Flowering PlantsPhotosynthesis in Higher PlantsPrinciples of Inheritance and VariationMolecular Basis of InheritanceStrategies for Enhancement in Food ProductionBiotechnology and It's ApplicationsOrganisms and PopulationsEnvironmental IssuesPlant KingdomPlant Growth and DevelopmentEcosystem
Zoology
Human Health and DiseasesBody Fluids and Its CirculationLocomotion and MovementNeural Control and CoordinationReproduction in OrganismsReproductive HealthStructural Organisation in AnimalsDigestion and AbsorptionExcretory Products and Their EliminationChemical Coordination and IntegrationHuman ReproductionAnimal KingdomBreathing and Exchange of GasesEvolution